frases

jueves, 31 de mayo de 2012

Otro día mundial sin tabaco

Hace exactamente un año, escribí una entrada en este blog, sobre el día mundial sin tabaco del año 2011.
Si accedéis, ya podéis ver que en ese tema añadí algunas entradas más de la misma etiqueta, que podéis seguir leyendo aquí.

Curiosamente, algo que me satisface es saber que ese artículo del año pasado es la entrada más visitada de esta semana y de todo el mes de mayo. Así que, por lo visto, hay bastante gente interesada en el asunto, para bien o para mal.

Pero este año, me voy a limitar a mencionar la entrada del año pasado y las demás entradas de esta etiqueta, y únicamente añadir de novo el artículo que ha colgado el mundo en su web. Mantendré la lectura de copyright realizando solo mención y copia literal obtenida del sitio web mencionado.




volver a elmundosalud.elmundo.es



Cada 31 de Mayo, la Organización Mundial de la Salud organiza el Día Mundial sin Tabaco, una iniciativa destinada a recordar los grandes perjuicios que acarrea el tabaco para la sociedad (no sólo para los fumadores), uno de los problemas más graves de salud pública.
Gráfico: Los efectos del tabaco en la salud


Gráfico: Las nuevas cajetillas de cigarrillos
Gráfico: Tragar el humo


Especial: ¿Quiere dejar de fumar?
T
TT

Sobre elmundosalud.elmundo.es
Copyright © 2000 El Mundo.





Por último, os informo de que en los próximos días el blog va a tener una limpieza de etiquetas –ya que, en mi opinión, hay demasiadas–… Así que tal vez durante un tiempo, sobre todo en entradas antiguas, haya alguna discordancia en cuanto a etiquetas se refiere. Pido disculpas por ello.
-- Post Edición. Las etiquetas están renovadas y mejoradas. También he añadido tres páginas, arriba las podéis ver, donde están las etiquetas agrupadas en tres categorías: ciencia, sociedad y magufadas y estulticias.
Leer más...

martes, 29 de mayo de 2012

Coleccionando falacias

Hola de nuevo.
Disculpad el enorme retraso que hemos tenido últimamente con la publicación de entradas en el blog, pero me temo que continuará por un tiempo más.
El motivo es que tengo demasiadas cosas en la cabeza y en la lista de tareas pendientes y no saco un trozo lo suficientemente largo de tiempo para escribir una entrada decente.
Sin embargo, mis retales temporales, demasiado cortos para hacer algo aquí, sí que son aprovechables en la tarea de combatir la pseudociencia, la superchería y el literalismo bíblico en favor de la ciencia. Como se puede observar en los acontecimientos de estos últimos días en el blog de Nicolás Gonella.

Si leemos atentamente su absurdo blog, podemos observar cómo ha continuado lanzando rebuznos que tratan de ser intentos vanos de contra-refutaciones a mis refutaciones de aquellas 101 eviudencias que "demuestran" que la tierra es joven.

Sin embargo, como podemos leer atentamente –si tenemos un mínimo conocimiento de ciencia–, no contra-refuta absolutamente nada. ¿Por qué? por un motivo muy sencillo. Porque utiliza falacias.
Recordemos que una falacia es un argumento que presume o aparenta ser correcto, pero que sin embargo, es incorrecto. De modo que cualquier refutación realizada con una falacia, es una refutación no válida. ¡Cuidado! Eso no convierte a la afirmación que ha intentado ser refutada en verdadera. No. Pero sí que convierte a la refutación en cuestión en una chorrada.

Y aquí, el señor Nicolás comete muchas, muchísimas falacias. Veamos las más remarcables.

Nuestro amigo, a veces, dice…
«Desde ahora, cuando nos encontremos con la misma tontería de que “algo pase rápido no prueba que la Tierra es joven”, simplemente diré: no prueba que la Tierra sea antigua, tampoco es concluyente de que sea joven, pero es un indicativo fuerte de que es joven»
Claro que no. No prueba que sea joven. Tampoco prueba que sea antigua. Por supuesto que no. Porque yo no estoy demostrando que la tierra sea antigua, sino que estoy demostrando que esas supuestas evidencias son falsas. Si alguna de las evidencias fuera cierta, fuera verdadera, su autor podría ganar un nobel. Y con esto, caes en la falacia de la falsa dicotomía al presuponer que si estoy demostrando que esas "evidencias" de la tierra joven son falsas, inherentemente también querré demostrar que la tierra es anciana. Algo que se viene repitiendo varias veces, por cierto…
«¿Dónde está la evidencia de que la Tierra no es joven?»
En esta en la que vuelve a caer, también cae en la falacia de ignorancia…
«¿eso es prueba de que la Tierra es vieja? No señor. La evidencia sigue en pie.»
Siguiendo con las falacias… aquí encontramos otra.
«No es posible que durante 300.000.000 de años se haya estado sedimentando material sin ser erosionado, porque no transcurrieron tantos años, sino muchísimo menos;»
Lo que aquí nos encontramos se llama falacia ad hoc. Niega la evidencia en favor de una hipótesis no demostrada, que refuerce su punto de vista inicial.

También suelta la siguiente perla.
«Por otro lado, teniendo en cuenta que la velocidad de deposición de los sedimentos se calcula midiendo la deposición sobre el tiempo, a través de una observación directa o testimonial y que esa deposición puede acelerarse por eventos catastróficos, entonces lo que decimos nosotros es verdadero y lo que dicen los evolucionistas es falso.»
En este caso, directamente el planteamiento es erróneo desde la base.
En primer lugar, obviamente, disponemos de datos observados en base a condiciones de laboratorio. Pero lo bueno que tienen las condiciones de laboratorio es que podemos modificarlas para emular cualquier evento natural, incluidos eventos catastróficos.
No disponemos de ninguna evidencia empírica que cite un evento catastrófico en el Gran Cañón desde las últimas glaciaciones. De modo que durante los últimos miles de años, no ha habido sobresedimentación. Es más. El Gran Cañón lleva erigido desde la formación del río Colorado –como es obvio, apréndase para esto el proceso de formación de un cañón– de modo que la evidencia nos indica que la formación de la columna del cañón es anterior; es decir, que los sedimentos se depositaron antes de que el río Colorado comenzara a erosionar la región.
Sabemos cuál es la velocidad de deposición de sedimentos promedio y conocemos las posibles variables en función de los posibles eventos catastróficos. Y ni aunque se hubieran sucedido eventos catastróficos uno tras otro sería posible que esa columna datada en 300 millones de años se hubiera formado en menos de 100.
Aparte que está DATADA. Evidencia que constantemente quieren rechazar porque "no creen" en la datación por isótopos.
Pero lo que más me sorprende de todo es la conclusión gratuita, mezcla de falacia de falsa dicotomía y argumento de ignorancia. Otra falacia más para la colección.

Veamos… ahora, tengo que poner la consecución de argumento y contrargumento.
Vary dijo: «El lago más antiguo del mundo es el Lago Eyre, de Australia, (…) cuando se inunda, presenta una concentración salina de sobresaturación. (…) Esa cantidad de sal, (…) nos sugiere que debe tener al menos 73000 años. Lo cual, por cierto, no cuadra con la idea de una Tierra de 6000 años. Eso nos indica que el planeta tiene por lo menos 73000 años.
Aún estoy esperando, por cierto, una sola prueba que demuestre que el diluvio citado en la Biblia haya ocurrido realmente. Ejem ejem.»
Nicolás responde: «¡Otra vez lo mismo! ¿Acaso no sabe el significado de la palabra “catástrofe”? Así que no, eso no indica que la Tierra tenga “al menos 73.000” años y por tanto no contradice en nada, la evidencia bíblica de que la Tierra tiene unos seis mil años (si no menos…).»

Vamos a ver si nos entendemos tú y yo. No existen evidencias de que haya ocurrido ningún evento catastrófico de gran magnitud en Australia en los últimos 10 000 años –ya que la Biblia NO ES una evidencia, sólo es un libro–. De modo que, si bien sí que es posible que haya habido un evento catastrófico que distorsione la medición del tiempo, éste ocurrió hace más tiempo del que ustedes presuponen que hubo un diluvio.
Además hay una cosa incongruente. Si esa región hubiera sido arrasada por un diluvio –una enorme cantidad de agua que llueva –por tanto, agua dulce– inundando todo a su paso, la cantidad de sal del lago habría DESCENDIDO, y no aumentado como ocurrió, ya que el exceso de sal habría difundido al resto del agua que está inundando las tierras.
Por el contrario, si el efecto de ese supuesto diluvio hubiera sido sobresalinizador, lagos como el Sanabria, por citar uno que me queda cerca, o el más famoso Ness, habrían sido también lagos salados.

Lo cual, por cierto, demuestra lo absurdo de un diluvio.
Pero es más. Nicolás remata con un…
«Aún estoy esperando una sola prueba al menos, que demuestre que el Diluvio especificado—con bastante detalles—en la Sagrada Biblia, no haya ocurrido (…). Movió las placas tectónicas, produciéndose una rápida deriva continental (...) y un elevamiento temporal del nivel del mar.»
Aquí se mezclan hipótesis ad hoc –por parte de Nicolás y también por parte del supuesto doctor Gendry, al que ya he refutado varias veces– con imposibilidades físicas.
La principal evidencia –que como hemos visto no es la única– que demuestra la no exisencia de un diluvio universal se resume en una pregunta. ¿Dónde está el agua ahora? También es interesante preguntar de dónde salió, pero… la pregunta más divertida, es preguntar dónde está ahora. No hay suficiente agua en el mundo para cubrir toda la tierra emergida. Por otro lado, además, esa deriva continental repentina se contradice con el paleomagnetismo, con la distribución de los seres vivos prehistóricos… y también con la existencia de continentes anteriores a Pangea.
Pero claro. Es que lo dice mi libro mágico.
Por cierto. No se me ha olvidado la falacia Ad Baculum, tanto con la Biblia como con el señor Gendry.
«Y ¿quiere que le diga—Vary—por qué se formó el Gran Cañón del Colorado? Quiéralo o no, se lo diré…Ya habrá adivinado, quizás: ¡por el Diluvio universal!»
Sí. Lo había adivinado. Y continuas aportando conclusiones basadas en una premisa falsa.
«Si hubiese comenzado a formarse hace unos supuestos “6.000.000 de años”, se seguirían formando ahora (o tal vez no, pero ¿por qué se detendrían?, ¡ay qué raro!), pero NO lo hacen.»
Por supuesto que lo hacen. Pero a una velocidad a la que tú no puedes verlo. Es una velocidad tremendamente lenta. Dada la tasa de erosión del Colorado –que está calculada–, tan solo se erosionan unos pocos milímetros cada año. Pero claro que el cañón se sigue formando. Si analizas los estratos, puedes verlo.

Luego encontramos grandes defectos de cultura científica en esta gente… Podemos ver en otro de sus infructuosos intentos de contra-refutacion, que suelta la siguiente tontería:
«Que el suelo tenga huecos de aire y una enorme cantidad de agua, no quiere decir que se puedan eliminar tan fácilmente.»
Lo que aquí nos encontramos tiene un nombre simple. Se llama ignorancia. Verás, señorito Nicolás, si usted obtiene una muestra de tierra humosa –que contiene una gran cantidad de huecos llenos de aire y agua– y lo comprime a gran presión y a una temperatura medianamente elevada, tú mismo puedes observar cómo la muestra se comprime, liberando el aire y el agua contenidos.
De hecho, ni siquiera necesitas altas presiones y temperaturas. Agarra la muestra, déjala en una bolsa, y espera tres o cuatro años. Y luego, mira a ver lo que ha pasado. ¿Ha encogido? no. Simplemente el aire y el agua han sido eliminados.

También dice que las columnas geológicas son mentira… me encantaría que me lo demostrara. Porque, como siempre, habla mucho y no demuestra nada.

¡Maldicióin! me dije a mi mismo que no iba a entrar a desmontar sus tonterías. Disculpadme. Última vez. Bueno. Ya os he dado el coñazo suficiente. … Sólo una más.
«Aunque claro, todo esto que yo digo, es “mentira”, porque los “santos” método radiométricos—demostrados “científicamente”—son todos “verdaderos” y las evidencias y testimonios verídicos son “falsos”. (?) Por favor, seamos serios.
OK. Seamos serios. Los métodos de datación radiométricos SÍ están demostrados científicamente –no así tu querido diluvio imposible–. No, no todos son verdaderos: algunos presentan fallos. Esos fallos los conocemos. No, los métodos de datación no son santos. No hay necesidad de denominar santo a nada ni a nadie en la ciencia. En la ciencia no hay milagros: sólo evidencias empíricas. Y sí, un testimonio puede ser falso, y se demuestra falso si éste es contrario a la evidencia. ¿Sabes por qué? Porque una evidencia empírica es una evidencia, y es empírica. De modo que sí. Cuando hablas de un diluvio es mentira. Cuando usas un testimonio, no estás usando una premisa válida, por tanto las conclusiones no tienen por qué ser correctas. Cuando usas la biblia estás usando premisas indemostrables, por tanto, no estás demostrando absolutamente nada.

Por cierto…
«el término “evolucionista” es correctísimo, pues el evolucionismo NO es una teoría científica, sino una ideología político-religiosa, más religiosa que otra cosa, aunque claro, de seudo-religión.»
Bueno. Verás. En primer lugar, sí que es una teoría científica. (1, 2, 3, 4, 5)
Y en segundo lugar, no tiene nada de religión. Carece de dioses. Carece de santos. Carece de ritos. Carece de libros sagrados. Carece de dogmas de fe. Simplemente se basa en el método científico y las evidencias.
«Refute y será refutado.»
Amen. Con la diferencia de que usted no refuta. Simplemente suelta falacias de forma indiscriminada y esgrime su ignorancia como si de ciencia se tratara.

La colección de falacias ha resultado ser la siguiente en este caso…

  • Ad Ignorantiam
  • Falsa dicotomía
  • Ad hoc
  • Partir de premisa falsa
  • Ad Baculum
Aunque realmente, exhiben muchas más –otras que he notado son las Ad Verecundiam, Ad Nauseam, y a mi propia persona, en repetidas ocasiones, Ad Hominem.


Bueno. Sólo quería remarcar aquí los principales absurdos que el señorito Nicolás Gonella y su calaña han estado esputando en su curioso blog. Para vuestro entretenimiento y el mío propio. Pero no sé si recomendaros que entréis en él… ya que hay que estar moralmente muy preparado para lo que te puedas encontrar. Como Un Tal Mad me dijo –apodo de alguien con quien charlo y debato de forma habitual en una red social–: En ese blog hay "demasiada ignorancia y demasiadas pocas ganas de dejar de ser ignorantes".

Podría seguir destripando sus inútiles argumentos falaces y sus mentiras. Pero tengo hambre, así que me voy a comer.

Leer más...

jueves, 17 de mayo de 2012

La Universidad de León celebra el Día Internacional de la Fascinación por las Plantas

Desde la Universidad de León se van a realizar una serie de actividades con motivo del día de mañana, 18 de mayo, día mundial de la fascinación por las plantas.

Entre las actividades se incluye una visita botánica guiada por el campus; en aquella que se realizará en el turno de las 12:30 un servidor acompañará guiando al grupo. También os recomiendo los talleres de ungüentos y remedios naturales, en los cuales, aunque yo no podrá participar, sé de buena mano que tendrán calidad científica.

Estáis todos invitados, y espero que os guste.

A continuación, el programa oficial, sacado de la web de UniLeón.

Leer más...

martes, 15 de mayo de 2012

La evolución en todo su esplendor

Desde hace unos días, me he visto inmerso en varias discusiones en ciertos blogs creatas (1, 2) de estos que no hay quien se crea que haya gente que puede ser tan sumamente retrógrada, y que nieguen las evidencias de una forma tan absurda, en favor de la literalidad de un libro metafórico de hace siglos –algunos de los capítulos, milenios–.
De modo que finalmente me he decidido a plantear este post, que promete ser largo, pero que para beneficio de todos, voy a ir separando en capítulos.

A continuación, pasaré a explicar las evidencias que demuestran el hecho evolutivo y que se ven explicadas gracias a la teoría sintética de la evolución, leyes evolutivas mediante. Y para que se entienda de forma correcta, pasaré a exponerlas de un modo que un estudiante de segundo de educación secundaria obligatoria pueda comprenderlo. O esa es mi intención. Ocho capítulos os esperan.

Antes de nada quiero añadir una cosa. Las demostraciones a las que voy a acudir, no están basadas en ninguna creencia. No voy a utilizar ningún libro. Tampoco voy a usar ningún testimonio de nadie. Ni los libros ni los testimonios tienen validez empírica. La Biblia tiene tanto valor científico como El Señor de los Anillos o Harry Potter. Y del mismo modo que se puede usar la Biblia para "demostrar" que la Tierra tiene 6000 años, yo puedo usar El Silmarillion para "demostrar" con el mismo grado de validez, que fue creada por Eru Ilúvatar y moldeada por la Canción de los Ainur, para que Hombres y Elfos convivan en armonía.
No. Eso no es científico. Voy a omitir todo tipo de fe, de juicio de valor, y me voy a centrar única y exclusivamente en los únicos argumentos que realmente sabemos con certeza que son correctos: las evidencias científicas empíricas.

Vamos allá.

1. ¿Qué es evolución?

La evolución es el proceso mediante el cual unas especies de organismos cambian anatómica, morfológica y genéticamente, a otras especies diferentes de las anteriores. 
Esta definición tiene que quedar bien clara, y hay algunos errores que los creacionistas cometen muy a menudo. Hay que tener en cuenta que…
  • Evolución no es que un gato se convierta en un rinoceronte
  • Evolución no es que un elefante se convierta en un avestruz
  • Evolución no es que una piedra se convierta en una mosca
Parecen tonterías, pero las tres son cosas que muchos creacionistas creen que es la evolución. Están equivocados.
Otras cosas que la evolución no postula, son…
  • La evolución no habla del origen de la vida; sólo de los cambios de especie a especie.
  • La evolución no afirma que el ser humano proceda del mono; poseemos un antepasado común con los monos.
  • La evolución no afirma que todo se produzca por azar. Solo una parte de la evolución es azarosa: las mutaciones. La selección natural NO es azarosa.
Todo esto lo iremos explicando poco a poco.

Esquema filogenético simple, pero fiel
del Órden Primates. No venimos del mono.
Sí de un antepasado común con los monos.
Además de decir la definición de evolución –citada ahí arriba– me parece importante incluir aquí los dos motores principales que mueven la evolución en su constante y lento avance. Las mutaciones y la selección natural. Si bien es cierto que existen más –transferencia génica horizontal, por ejemplo–, me voy a centrar en estos dos, que son los importantes.

2. La mutación beneficiosa

Muchos creatas afirman que no existe algo así como una mutación beneficiosa. Afirman que las mutaciones nunca son positivas, o que la positividad de las mismas es irrelevante.
Nicolás Gonella dice en su blog, intentando sin éxito contradecir las evidencias científicas, y cito textualmente…
No se puede hacer omisión, de lo que no existe, es decir de una ganancia de función. Las mutaciones positivas son muy escasas, hasta tal punto que son irrelevantes, más aún con su dependencia del ambiente. Una mutación supuestamente “positiva”, a la larga termina siendo perjudicial, porque el individuo no logra adaptarse al ambiente que estaba diseñado para que ese individuo tuviera una configuración genotípica determinada, adaptada a ese ambiente. Si se modifica el diseño, por una mutación, entonces siempre será perjudicial, siempre el individuo quedará inferior a lo que era antes, desde un punto de vista genético.
Esto es falso. Y vamos a demostrar que es así. Pero para eso, primero hay que explicar un poco de genética.

2.1 El ADN y las mutaciones

El ADN –Ácido desoxirribonucleico– es una molécula que forma una doble cadena en espiral, y a partir de la cual, se pueden sintetizar, mediante una codificación dada, las proteínas, que se encargan de dar forma, función y estructura a todo orgánulo celular, a toda célula, y a todo organismo. El ADN es la molécula donde se encuentra el mensaje original para codificar un ser vivo. Todas las células del cuerpo tienen, originalmente, el mismo ADN.

La cadena de ADN, como toda cadena, se encuentra compuesta de eslabones. En concreto, cuatro tipos de eslabones diferentes. Llamamos a estos eslabones los nucleótidos, y son la Adenina (A), la Citosina (C), la Guanina (G) y la Timina (T). 

La secuencia en la que se organizan estos cuatro nucleótidos es la que forma el mensaje. Y todo mensaje presenta un código. En este caso particular, el código se conforma de "palabras" compuestas por tres nucleótidos (o letras), que llamamos codones. Las cuatro letras, combinadas en grupos de tres, dan un total de 64 combinaciones posibles. A cada combinación le corresponde con un aminoácido diferente –del mismo modo que a cada palabra le corresponde un significado–. 

Los aminoácidos son las unidades básicas que forman las proteínas, que son las que van a dar lugar a la forma, función y estructura del organismo vivo dado. Además, los aminoácidos –que en las proteínas, son 20– son diferentes entre ellos, y un cambio en un aminoácido puede provocar un cambio en toda la proteína.

Y aunque hay aminoácidos que pueden conferirse mediante varias combinaciones de codón (por ejemplo, GGU y GGC forman, ambos, el aminoácido Glicina), cada combinación fabrica siempre el mismo aminoácido (por ejemplo, AUU produce Isoleucina, y SIEMPRE Isoleucina).

Una de las propiedades que tiene el ADN es la de replicarse. Puede crear copias de si mismo, en un mecanismo de replicación semiconservativa –en el cual, una de las hebras de la nueva cadena formada es la antigua, y la otra es una copia nueva–.

Y durante las copias, en ocasiones, se producen errores. La maquinaria bioquímica que se encarga de la replicación no es perfecta, y puede pasar, de vez en cuando, que la enzima que tiene que meter una A, se equivoque y meta una C, o elimine la A y no meta nada, o meta dos A seguidas. Por ejemplo. Eso son mutaciones. Existen muchísimos tipos de mutaciones, pero no voy a entrar a explicarlos todos. Solo me voy a centrar en los efectos que cualquier mutación puede provocar.

2.2 De la mutación al cambio de proteína

¿Y cual es la repercusión de estos cambios?
Veámoslo con ejemplos.
Supongamos un caso muy simple de una proteína –realmente es un oligopéptido, porque el que voy a escribir a continuación solo tendrá ocho aminoácidos–. Primero voy a colocar la cadena de ADN, debajo el ARN mensajero que se transcribe del primero, y debajo, el resultado en forma de aminoácidos. Usaré las abreviaturas oficiales de tres letras de los aminoácidos, y las iniciales de los nucleótidos, para que sea más comprensible.
Se marcará con una almohadilla (#) el inicio y el fin del péptido, a sabiendas de que el ribosoma comienza siempre a leer con una Metionina (AUG) y concluye siempre con uno de los tres corones "Stop" (UAA, UAG o UGA), que se marcarán en negrita en el ARN.

ADN: CCATTACTGTAGTTAAAACTGATAGCGATTACATTTTATT
ARN: GGUAUGGACAUCAAUUUUGACGUGCGCUAAUGUAAAAUAA
Prot: -#MetAspIleAsnFenAspValArg#-

Bien. Ahora vamos a ver qué ocurre si sufre una mutación. Yo he mencionado varios tipos de mutación. Para comprobar los diferentes efectos, voy a mencionar tres mutaciones de ejemplo. La primera de ellas  será sustituir la segunda G por una T. La segunda mutación será sustituir la tercera A por una T. Y la tercera mutación será eliminar la quinta A. En todos los casos, marcaré en negrita verde en el ADN, el ARN y la proteína el lugar de la mutación, mientras que en el ARN seguiré marcando las secuencias de inicio y fin.

ADN: CCATTACTGTATTTAAAACTGATAGCGATTACATTTTATT
ARN: GGUAUGGACAUAAAUUUUGACGUGCGCUAAUGUAAAAUAA
Prot: -#MetAspIleAsnFenAspValArg#-

¡Sorpresa! con la primera mutación no hemos sufrido ningún cambio en la proteína. Esto es porque hay tres codones diferentes que codifican para Ile: AUU, AUC y AUA.

ADN: CCATTACTGTTGTTAAAACTGATAGCGATTACATTTTATT
ARN: GGUAUGGACAACAAUUUUGACGUGCGCUAAUGUAAAAUAA
Prot: -#MetAspAsnAsnFenAspValArg#-

Isoleucina (Ile)
Asparagina (Asn)
Con la segunda de las mutaciones, nos encontramos que hemos cambiado la Ile por un Asn. Esos dos aminoácidos son muy diferentes, como podemos observar. Mientras que la asparagina es de carácter básico la isoleucina es neutro. Además, la rama de la Ile tiene cuatro carbonos, mientras que la de la Asn tiene solo dos. Ese cambio sutil en uno solo de los nucleótidos ha provocado que la proteína sintetizada sea notablemente diferente. Pero vamos un poco más allá.

ADN: CCATTACTGTAGTTAAACTGATAGCGATTACATTTTATT
ARN: GGUAUGGACAUCAAUUUGACGUGCGCUAAUGUAAAAUAA
Prot: -#MetAspIleAsnLeuTreCisAlaAsnValLys#-

Una delación de una base (que es lo que hemos producido) no solo cambia el aminoácido en el que estaba la base antes, sino toda la proteína desde ese punto, ya que el mensaje completo ha cambiado. Recordemos que nos movíamos en bloques de tres en tres. Cuando antes teníamos UUU, ahora solo nos queda UU, y tenemos que coger el siguiente nucleótido para poder leerlo: UUG; de este modo, hemos dado un salto en toda la secuencia, que se nos traduce como un cambio en toda la proteína, y no es sólo un cambio de un aminoácido; una buena parte de los aminoácidos son diferentes, e incluso la longitud de la molécula ha cambiado. Antes teníamos un péptido de 8 aminoácidos, ahora es de 11.

Del mismo modo, podríamos tener una mutación por duplicación de un nucleótido; de esta forma, no solo estaríamos cambiando toda la proteína, sino que además, estaríamos incorporando nuevo material al genoma del organismo. 

2.3 De la proteína modificada al cambio de función

El hecho de que se cambie una proteína de tal forma, puede provocar muchas consecuencias.
Tal vez la proteína deje de funcionar. O tal vez funcione de una forma diferente. Tal vez pierda su antigua función y gane una función nueva. Eso provoca, queramos o no, cambios en el organismo.

El caso es que las mutaciones, algunas, terminan produciendo cambios en el organismo que las sufre. Muchos cánceres son producto de una mutación. Pero, por ejemplo, que existan personas con ojos azules también es, de causa primera, una mutación.

Me voy a centrar en una mutación concreta, que es el albinismo. El albinismo es una mutación que hace que un organismo deje de expresar coloración en la piel y el pelo: el organismo se queda de color blanco.

¿Es esta mutación beneficiosa o perjudicial? Eso ya no depende de nuestro criterio, sino de cómo es el ambiente en el que esta mutación ocurre. Lo cual me lleva a hablar del segundo motor de la evolución.

3. Seleccionando

3.1 El mutante en clima hostil

Si observamos una manada de zorros en una región boscosa de clima templado, nos encontramos con que la mayor parte de éstos son de color rojizo. En primavera y verano, el sol es tapado por los árboles, generando una penumbra en el sotobosque, que favorece el pelaje oscuro: las presas del zorro no lo ven venir. Durante el otoño y el invierno, las hojas caídas, que son de color pardo rojizo, y los arbustos secos, siguen favoreciendo a los usuarios de estas tonalidades, que siguen pudiendo atacar sin ser vistos.

Si en este ambiente concreto, nace un zorrito blanco, producto de una mutación –que como hemos visto, es algo que puede ocurrir–, éste se encuentra con un problema.
Durante la primavera y el verano, el sotobosque está en penumbra, y el pelaje blanco llama mucho la atención: al animal le cuesta alimentarse, porque sus presas le ven venir.
Durante el verano y el invierno, el sotobosque está cubierto de matorrales pardos y hojas secas. Sigue siendo el pelaje blanco un gran problema para nuestro pequeño zorro blanco, ya que sigue llamando mucho la atención. Termina por morir de hambre antes de reproducirse. No deja descendencia y su genoma, su ADN, donde estaba incluida la información del pelaje blanco, desaparece en el olvido.

3.2 El mutante en su nuevo clima

Pero el clima es una entidad cambiante. Sabemos que el clima cambia. Con tan solo observar los depósitos que aparecen en una turbera, o las formaciones geológicas producto de glaciares, podemos observar que a lo largo del tiempo el clima cambia, se modifica. Donde antes había río, ahora puede haber secarral. Y donde antes había un bosque templado de caducifolias, ahora puede haber, por ejemplo, un glaciar.

Centremonos en esa opción. Al fin y al cabo estamos en un ejemplo.
Imaginemos que nuestra especie de zorro rojo vive en varios bosques de la región. Pero porque el clima es una entidad cambiante –y me da igual cuál sea la causa de dicho cambio, eso no entra en el campo de la teoría evolutiva– uno de los bosques en los que vive nuestro zorrito se ve, en pocas décadas, cubierto por nieves perpetuas. La vegetación cambia. El paisaje cambia. Y nuestros zorros rojos, de repente, notan que les cuesta más alimentarse. Antes, durante todo el año, su pelaje pardo rojizo les beneficiaba para pasar desapercibidos y cazar de forma más eficiente. Pero ya no. Ahora, el paisaje es siempre blanco, y el color pardo hace que se les vea muy bien incluso de lejos. Se ven obligados a cazar de noche, pero es algo que nunca han hecho, y les cuesta mucho trabajo.
Sin embargo en esta población, nace un zorrito mutante, con el pelo blanco.
Las presas no son capaces de verle, pues se mimética perfectamente con el fondo blanco del paisaje. Este zorro se alimenta bien. Crece fuerte y sano. Y se aparea al llegar a adulto mucho más fácilmente que cualquiera de sus hermanitos marrones, que están débiles y sin energía.
Y si se aparea con una zorrita parda –porque nuestro zorro blanco es el único que ha nacido blanco de todos los demás– y consigue sacar adelante a la manada, porque él puede cazar para ella, y la tiene bien alimentada. Y algunos de los cachorros nacen pardos –por mamá–, y otros blancos –por papá–.

Y la historia se repite generación tras generación. En este blanco paisaje, los zorros blancos comen más y mejor, y los zorros pardos tienden a morir de hambre. El pelo blanco será cada vez más habitual, y el pelo pardo irá desapareciendo paulatinamente.

Ha aparecido un nuevo "tipo" de zorro. Un zorro blanco, diferente, genética y morfológicamente, al zorro rojo original. El zorro ha EVOLUCIONADO. 

Esto lo hemos observado con todas las especies, animales y vegetales, de que disponemos para uso doméstico. Desde la banana hasta la oveja, hemos llevado a cabo artificialmente la selección. En vez de una selección natural, realizamos una selección artificial. Pero sigue siendo una selección al fin y al cabo.
Y leyendo de nuevo el fragmento de nuestro amigo Nicolás…
Si se modifica el diseño, por una mutación, entonces siempre será perjudicial, siempre el individuo quedará inferior a lo que era antes, desde un punto de vista genético.
Hemos descubierto mediante este sencillo ejemplo, que es FALSO. Que una mutación sea beneficiosa o perjudicial no es algo absoluto y fijo, sino que es dependiente del ambiente. Muchas mutaciones que pueden parecer perjudiciales en un ambiente dado, pueden resultar muy beneficiosas en otros tipos de ambientes. Me viene a la cabeza incluso, unos curiosos ejemplos en que la desaparición de fragmentos completos de genoma es beneficiosa para el organismo: caso de parásitos y endosimbiontes. Si tengo menos genoma, tengo menos cantidad de genoma que replicar y gasto menos energía en replicarlo.

Entonces, un creacionista levanta la mano y dice. "Pero señor, eso de los zorros no es macro-evolución, sino micro-evolución. Los dos zorros, el blanco y el rojo, siguen siendo la misma especie, son solo variedades". 

Y yo responderé: "¿Está usted seguro?"

Ese es otro problema de los creatas. No comprenden que lo que ellos llaman "macro-"evolución no es más que la consecuencia inherente e inevitable de la que llaman "micro-"evolución.

Pero vamos a explicarlo, también.
¿Esos dos zorros son de la misma especie, o son especies diferentes?

Para eso, hay que hablar de la capacidad acumulativa de los cambios.

4. La lotería seleccionada

Como hemos visto, hay dos principales factores que mueven el proceso evolutivo. Uno es la mutación. El otro, la selección.

Si contáramos solo con la mutación, tendríamos un problema. Y es que necesitaríamos que para que se diera la evolución, todos los cambios ocurrieran a la vez; algo que es prácticamente imposible.
Sin embargo, el factor selección es lo que nos permite acumular una mutación tras otra, adquiriendo, perdiendo o modificando características, funciones y material genético.

El simil de la lotería me parece uno de los mejores.

Supongamos que tenemos un número de cuatro cifras de una lotería. El 5498.
La probabilidad de sacar ese número de una sola vez, de cuatro bombos con 10 cifras cada bombo, y en el orden correcto, es de uno entre 10 000 (P=0,0001). Una proeza realmente complicada.

Sin embargo, si vamos sacando de los cuatro bombos, y cada vez que uno de los bombos acierta, GUARDAMOS ese número –realizamos la SELECCIÓN–, la probabilidad de acertar cambia: ahora es de uno entre 40 (P=0,025)

Voy a hacer una prueba. Otro experimento. Para que no os quejéis. En la columna de la izquierda, cuatro números aleatorios en unos cuantos intentos, sin guardar la tirada. En la columna de la derecha, los mismos intentos –las mismas tiradas–, pero guardando las tiradas exitosas. Lo voy a hacer con dados de rol de 10 caras, que son muy apropiados para este tipo de experimentos, y lo voy a realizar hasta que uno de los dos resultados tenga éxito completo.

1. 0638 / 0638
2. 6646 / 6648
3. 8696 / 8698
4. 7599 / 7598
5. 9130 / 9198
6. 5273 / 5298
7. 1658 / 5698
8. 8070 / 5098
9. 1439 / 5498
Como podemos observar, en nueve tiradas, guardando el valor exitoso –es decir, con selección– hemos logrado el objetivo. 
La evolución, por tanto, no es un proceso únicamente azaroso.

5. La nueva especie

Existen muchas definiciones de especie; prácticamente cada biólogo te va a definir el término "especie" un poco a su modo. Pero todos los biólogos del mundo coinciden en una cosa. Dos organismos no pueden ser de la misma especie si no pueden reproducirse entre si según su sexo y dar descendencia fértil.

Es cierto que existen híbridos entre muchas especies. Siendo los híbridos fértiles muy raros, y solo mínimamente frecuentes entre los vegetales.

Cuando dos organismos morfológicamente diferentes pueden reproducirse dando descendencia fértil, podemos dudar de si son o no la misma especie.

Sin embargo, no cabe ninguna duda de que si dos individuos que, siendo ambos fértiles y del sexo opuesto, no pueden reproducirse, es que no son de la misma especie

Planteo ahora otro supuesto. Del mismo modo que una mutación puede provocar un cambio en el color del pelo, puede también provocar un cambio en el órgano reproductor. Un cambio anatómico. O tal vez, puede producirse una incompatibilidad genética. Siguen siendo cambios que son posibles mediante mutaciones. Como ya hemos visto, las mutaciones seleccionadas por el ambiente tienen un carácter acumulativo. De modo que los cambios que pueden ocurrir son, en ocasiones, de enormes proporciones.

Se han observado casos. Ya los cite en este mismo blog, aquí. Pero en resumen, podemos citar, por poner algunos ejemplos…
  • La oveja doméstica, producto de evolución a partir de las variedades salvajes. En reproducción no dan descendencia fértil, ergo son especies diferentes.
  • Los procesos de especiación de Drosophila pseudoobscura llevados a cabo por la Dra. Diane Dodd (1989). Las poblaciones obtenidas no podían reproducirse entre si, ergo eran especies diferentes.
  • Poliploidia de Primula floribunda cuyos descendientes poliploides ya no pueden reproducirse con los organismos no poliploides, por incompatibilidad genética. Especies diferentes.
  • Culex molestus, especiado desde C.pipiens al verse aislada una población durante décadas. No pueden reproducirse entre sí. (Burdick, 2001)
A todos estos ejemplos, los más evidentes, podemos añadir los cambios que se producen al cultivar bacterias. Vamos a poner, de nuevo, un ejemplo de evolución. Un experimento que se puede repetir casi en cualquier laboratorio de microbiología mínimamente equipado.

6. Bacterias evolucionando - La prueba genética

Disponemos de cuatro placas de petri, con el mismo medio de cultivo en todas ellas.
En la placa 1 sembramos una bacteria.
Separamos las bacterias crecidas en dos placas. La original (1) y una nueva placa 2. A esta placa 2, añadimos estreptomicina (Str).
Cuando hayan crecido, separaremos las que hayan crecido, de nuevo en dos. Una de ellas, la original (2), y otra nueva, 3.
Repetimos la operación, añadiendo penicilina (Pnc) a la placa 3. De nuevo dejamos crecer y la dividimos en dos, y a la placa nueva, la 4, le añadimos amoxicilina (Amx). Dejamos crecer.

De modo que nos encontramos con que la relación placa-antibiótico será la siguiente.

AB P1 P2 P3 P4
Str -  +  +  +
Pnc -  -  +  +
Amx -  -  -  +

Bien. Si ahora tomamos una muestra de las bacterias supervivientes de cada una de las placas y hacemos una extracción de su ADN, y lo pasamos por un gel… en resumen, hacemos un análisis de ADN comparando estas cinco placas, nos encontramos con que los "parecidos familiares" siguen este esquema.

1 2 3 4
\ \ \ |
 \ \ \|
  \ \ |
   \ \|
    \ |
     \|
      \
¿Qué representa esto? Sencillo. Que primero se separó la bacteria 1 –sensible a Str– del resto, que, mutantes, se mantuvieron iguales entre sí–resistentes a Str–. Después, con la incorporación de la Pnc, 3 y 4, nuevas mutantes, se hicieron resistentes, mientras que 2 se mantuvo sensible. Finalmente, vemos que las bacterias 3 y 4 se separan recientemente, por adquirir una la resistencia a Amx (4) que no adquirió la otra (3).

Estamos observando un dendrograma filogenético.

Y como dijo Jackes Monod, «Lo que es válido para la bacteria es válido para el elefante». Si nosotros hacemos ese mismo estudio genético en otros organismos, podemos comprobar, igual que lo hacemos con las bacterias, la ascendencia de los diferentes linajes.

7. ¿Existen más pruebas?

Por supuesto que existen. Si no fuera poco la observación directa que he expuesto, y las inferencias directas obtenidas por las evidencias genéticas existentes, disponemos de un amplio registro fósil que, si bien incompleto, es perfectamente congruente con el hecho evolutivo –y por cierto, inconsistente con la idea creacionista–. 
La datación por radiocarbono es correcta –por mucho que a Nicolas o a JuanC les moleste–.
Las evidencias paleoclimáticas existen.
Las evidencias paleontológicas también.
Y las paleogeográficas.
Y las anatómicas.
Pero esas, las dejaremos para otro día.

8. Dedicatoria y bibliografía

Estimados amigos creacionistas. Si habéis conseguido llegar hasta aquí, me alegro –y me sorprenderé–.
Sólo haceros una recomendación. La evolución no es cosa de religiones, credos o fe. La evolución es cosa de ciencia. 
Si vais a hablar de evolución, criticar, falsar, o intentar destrozar la evolución, hacedlo desde la ciencia. Citar testimonios y libros no es válido en ciencia. Citad evidencias científicas y dejad de decir tonterías.


Un saludo.

P.D. Las aves SON, de hecho, reptiles. Aunque no lo queráis reconocer.


Bibliografía citada:

Dodd, D. (1989) Reproductive isolation as a consquence of adaptive divergence in Drosophila pseudoobscura. Evolution 43:1308-1311.

Burdick, A. (2001). Insect From the Underground - London, England Underground home to different species of mosquitos. Natural History.


Leer más...

miércoles, 9 de mayo de 2012

P.L.Nicus y los métodos de datación

Bueno. Últimamente estoy un poco más ajetreado de lo habitual y tengo el blog un poquito dormido.

Os comento brevemente mi agobio, que así descargo.

  • El domingo pasado fue mi cumpleaños (27 tacos).
  • La asociación El Pacto de las Janas –a la cual pertenezco– esta montando un evento: el Level Up León - Apocalipsis… y un servidor es el pringado que se ocupa de montar los vídeos promocionales –una serie de cortos que os animo a que vayáis viendo–
  • Además, el día 25, día del orgullo friki, y día de la toalla, se celebrará en León una Fiesta Friki –como ya es tradición–, la cual, ¿sabéis? un servidor está inmerso en su preparación.
  • Y todos los viernes, a partir de las cinco y media, tenemos el cineforum ya anunciado.
Pues eso.

Pero así y todo, he conseguido sacar tiempo para descojonarme entretenerme con las ideas de un nuevo creacionista-literalista bíblico que yo conocía de debates varios en el famoso blog Creacionismo especial, y que me he enterado hace unos días que también tiene un blog propio. El blog no tiene ningún desperdicio. Las entradas tienden a ser largas y aburridas –aunque no todas lo son, es la tónica–, y lo "interesante" de cada artículo está siempre donde las letras cambian de color. La estética del blog es, para mi gusto, demasiado recargada,… pero no estoy para criticar un blog.

El caso es que este señor, "Príncipe" "Lord" Nicus –lo de que tenga el título de Príncipe y de Lord me lo reservo en duda– en su blog ha realizado una contrarréplica a mis refutaciones sobre las 101 evidencias de la tierra joven.

Podría realizar ahora una transcontrarréplica y seguiríamos así eternamente. En vez de eso, me voy a limitar a señalar el fallo más grande que ha tenido en su contrarréplica y a corregírselo. El resto de premisas, obviamente son incorrectas, y es algo que ya se lo he dejado en un comentario.

De modo que es aquí donde empieza el artículo de hoy, de verdad.
Esto va a ser largo, os vaticino. Pero si estáis estudiando el bachillerato o una carrera en la que entre el método de datación radiométrica en el temario, os será muy interesante.
Curiosamente, yo debería cobrar por lo que voy a escribir a continuación. Bien podría ser una hora de clase en una academia.

Y P.L. Nicus, te recomiendo que lo leas detenidamente. ESTO es ciencia. No hay ninguna creencia en lo que voy a poner a continuación. No hay ningún acto de fe. Es ciencia pura y dura.

Primera parte: el caso

Leáse del blog de P.L. Nicus
«(…) realmente el ADN dura cientos de años y el denominado como “ADN antiguo”, que se usa para decir que la Tierra tendría al menos 50.000 años, en la datación con el PCR, está altamente sesgado por supuestos, tal como lo están los métodos de datación del carbono 14. Lo que ocultan (o no se dan cuenta) los evolucionistas es que esas “calibraciones”, se hacen con el presupuesto de que la Tierra no es joven sino antigua, calibrando el reloj genético a cinco millones de años, para el caso del hombre. En cambio, si se ajusta el reloj, midiendo el rango de mutaciones actuales, se tiene que la fecha aproximada del surgimiento del hombre es entre 6000 y 6500 años, lo cual es consistente con las duraciones centenarias del ADN y de paso, con lo que dice el Génesis.
Por lo tanto es falso decir que hay un método de datación absoluta de fósiles, porque todos se calibran con parámetros pre-diseñados; no hay manera exacta de saber la datación de un fósil, a no ser que de antemano conozcamos con exactitud la fecha de la muerte de tal o cual ser vivo, que posteriormente se fosilizó. Así se han encontrado fósiles de animales, que se sabe (por testimonios certeros) que murieron hace—por ejemplo—unos treinta años, y con los métodos de datación, nos da que murieron hace miles e incluso millones de años. En resumen: los métodos de datación radiactivos no son seguros, entonces es erróneo decir que el ADN pueda durar “millones de años si se tiene el correcto método de conservación”.»
Volviendo a leer detenidamente la joyita presentada aquí, nos percatamos de muchos, muchísimos errores. Voy a marcar los más característicos y entraré a explicar con ciencia cada una de las cosas.

Segunda parte: paleoADN

el ADN dura cientos de años y el denominado como “ADN antiguo”, que se usa para decir que la Tierra tendría al menos 50.000 años, en la datación con el PCR, está altamente sesgado por supuestos, tal como lo están los métodos de datación del carbono 14
Hace algunos años, la paleontóloga Mary Higby Schweitzer y su grupo, hallaron en un yacimiento de Montana una serie de fósiles incluidos en una matriz rocosa especialmente resistente. En ese yacimiento se encontraban extrayendo un fémur datado en 70 millones de años de antigüedad de un gran terópodo carroñero: Tyrannosaurus. El fémur medía 1,07 metros, y se rompió accidentalmente durante la extracción. Cuál fue la sorpresa, cuando descubrieron que en el interior del hueso fósil había restos de tejidos blandos, de los cuales se ha conseguido extraer paleoADN. Obviamente, el paso del tiempo no ha perdonado y éste se encuentra en gran medida: tiene unos enormes saltos en la secuencia. Pero el ADN está ahí. Además se descubrió que el tipo de tejido coincidía con el de las grandes aves corredoras como el avestruz. No obstante, lo que también nos hemos encontrado es una enorme cantidad de proteínas. Las proteínas son moléculas altamente resistentes. Gracias a las técnicas de proteómica podemos deducir a partir de una proteína cuál es la secuencia de ADN que ha dado lugar a ésta.

Pero a lo que vamos. Esto puede demostrar dos cosas. Plantearé dos hipótesis.
a) La datación es incorrecta, y el fósil tiene cientos de años, o unos pocos miles, nada más.
b) El ADN puede durar más de 70 millones de años.

Pasemos a intentar demostrar una y otra.
Para demostrar esta primera premisa, necesitamos desconfigurar todo el sistema de eras geológicas, aceptado por kla comunidad científica. Existen cientos de miles de pruebas que demuestran que el planeta es muy anciano. Que los dinosaurios –salvo las aves– y el hombre nunca han coexistido. Que los dinosaurios –de nuevo, excepto las aves– se extinguieron hace 65 millones de años.

Para demostrar la premisa b, solo necesitamos analizar otros huesos largos de animales grandes, que hayan sido encontrados en sustratos muy conservativos –es decir, que murieron, rápidamente quedaron enterrados, y apenas hubo bioturbación del cadáver, y el sustrato sea propicio para la conservación–. Curiosamente desde aquel descubrimiento se han hallado más huesos con tejidos blandos, y con ADN. Algunos incluso en huesos que están en museo desde hace décadas. Es decir. Si todas las pruebas apuntan a que esas criaturas tienen millones de años de antigüedad y nos encontramos con ADN en algunas de ellas, significa que el ADN, en según qué condiciones, puede permanecer millones de años.

Por cierto. El PCR no es una técnica de datación. Y el Carbono-14 no puede usarse con ejemplares de más de 60000 años. No es válido para datar un dinosaurio.
Aunque claro… ¿Cómo sabemos de verdad que el 14C tiene ese límite? ¿Y cómo sabemos que esos dinosaurios tienen esa antigüedad?

Eso me lleva a la tercera parte.

Tercera parte: calibraciones

 Lo que ocultan (o no se dan cuenta) los evolucionistas es que esas “calibraciones”, se hacen con el presupuesto de que la Tierra no es joven sino antigua, calibrando el reloj genético a cinco millones de años, para el caso del hombre. En cambio, si se ajusta el reloj, midiendo el rango de mutaciones actuales, se tiene que la fecha aproximada del surgimiento del hombre es entre 6000 y 6500 años, lo cual es consistente con las duraciones centenarias del ADN y de paso, con lo que dice el Génesis.
Estás hablando, en primer lugar, de un reloj genético. Efectivamente, se tiene que calibrar. Pero no lo estamos calibrando así por gusto, sino porque los métodos de dotación absolutos es lo que nos dice que hagamos.
Espera… dices…
es falso decir que hay un método de datación absoluta de fósiles, porque todos se calibran con parámetros pre-diseñados
Es falso decir que eso es falso. Sí que existen métodos de datación absoluta.
Vamos a explicar brevemente en qué se basa un método de datación radiométrico.
Voy a utilizar el método del 14C aunque cualquier otro método radiométrico funciona igual. Pero como antes lo mencionaste, pues a ello me pongo.

Propongo un experimento.
Tomo una muestra. Por ejemplo, un caracol. Vivo. Y mido la cantidad de 14C que presenta, respecto a la cantidad total de C. Vamos a llamar a esta cantidad, N(0) (Núcleos en tiempo 0)
Vemos que la cantidad es dependiente de la atmósfera.

Mato al caracol. Ergo, deja de respirar. Ergo, deja de introducir 14C. Como es un isótopo radiactivo, se irá, lentamente, descomponiendo. Esperamos una cantidad de tiempo dada. ¿Por ejemplo 5 años? Y analizo la cantidad de 14C que nos queda. También lo analizo a 10 y a 15 años.

Y al analizar los datos nos damos cuenta de una cosa. Que los valores de 14C relativos al total inicial  N(0) son:
  • N(5)=0,9994N(0)
  • N(10)=0,9876N(0)
  • N(15)=0,9815N(0)
Observamos un decaimiento lento pero constante. En cinco años ha decaído un 0,06%, en diez ha decaído un 1,24% y en quince ha decaído un 1,85%.
Si analizamos, y hacemos los cálculos precisos nos percatamos de que el decaimiento viene dado por esta fórmula:
N(0)·e-λt=N(t) donde t es el tiempo estudiado, y λ es igual a, aproximadamente, 0,000124. Y todas las veces que usamos el método en cuestión nos da el mismo resultado. Curioso, ¿verdad?

Y a partir de esa fórmula (dándole un poco la vuelta así: -1/λ·lnN(t)/N(0)=t ) podemos deducir, por tanto, que analizando la cantidad de 14C que se presente en una muestra –conociendo la cantidad original que tenía inicialmente– podemos calcular la antigüedad de algo.

Por ejemplo. Una muestra que presenta el 50% de 14C de lo que tenía originalmente, tendrá, según el cálculo que nosotros hemos analizado, una antigüedad de 5590 años. Eso sería el tiempo de semidesintegración, y es constante para cada isótopo. Realmente, con estos tres datos, y la aproximación de decimales, tenemos un breve rango de error. Podemos solucionarlo tomando muestras más antiguas pero cuya antigüedad conozcamos. Por ejemplo, a partir de tumbas que estén adecuadamente fechadas. Nos basta con conocer el año de la muerte.

Si extendemos el experimento para hacer los cálculos más exactos nos encontramos con que realmente el período de semidesintegración del  14C es de 5730 años. Hemos tenido un error de 140 años… o lo que es lo mismo, un error de un 2,4%, al hacer el cálculo con decimales redondeados.

Hemos dicho que esto es dependiente de la atmósfera.
Sin embargo, no hemos encontrado ninguna discrepancia en todas las pruebas que hemos realizado. Solo encontramos errores a partir de 1950, que el ser humano y sus cosas han estado cambiando la cantidad de  14C de la atmósfera. Pero eso tiene una fácil solución. Tomamos como estándar para la calibración la cantidad de  14C que había en 1950, y listo. De modo que cuando estamos usando el método del  14C estamos calculando años atrás contando desde 1950.

Ahora yo me encuentro con el cadáver de un señor, congelado en los andes. Tiene un 13% del  14C que debería tener. Haciendo el cálculo tenemos este resultado.

Si el cálculo lo hago con la aproximación que hemos realizado nosotros, nos encontramos con que el hombre tiene una antigüedad de 16453. Si hacemos el cálculo con el dato estandarizado –el que se ha obtenido después de miles de pruebas realizadas por miles de científicos de todo el mundo– nos indica una antigüedad de 16389. De nuevo nos encontramos con un breve error que carece de importancia en cuanto a la magnitud de datos que estamos manejando.
Dado que la cantidad de  14C es constante en la atmósfera, sabemos con un rango de error muy reducido que la edad de ese hombre es de 16389 años antes de 1950. Es decir, ese hombre se congeló en el año 14439 a.C.

¿Dónde está aquí esa calibración en vistas a una Tierra anciana? No tenemos en cuenta ninguna edad. Ni joven ni vieja. La Tierra podría tener 20 000 o 800 000 000 años, que el método de datación no cambiaría. Pero lo que sabemos es que, por la existencia de ese señor congelado del 14439 a.C., al menos, la tierra tiene (a fecha 2012) más de 16451 años. ¿O no?

Cuarta parte: la carga de prueba


se han encontrado fósiles de animales, que se sabe (por testimonios certeros) que murieron hace—por ejemplo—unos treinta años, y con los métodos de datación, nos da que murieron hace miles e incluso millones de años.
En primer lugar, eso no es un fósil sino un prefosil. Para ser considerado fósil tiene que transcurrir un largo periodo de tiempo, no 30 años.

En segundo lugar, tenemos un problema. Ese señor dice que vio a ese animal vivo hace treinta años. Y el método de datación radiométrico nos dice que murió hace dos mil.

¿Quién dice la verdad, el señor o el método de datación?… Repetimos la datación. Mismo resultado. ¿Hemos cometido algún error? Cambiamos de método de datación. Usaremos otro, por ejemplo, Cobalto-60 que tiene un periodo de semidesintegración de 5271 años, y también nos vale. Mismo resultado. Usaremos un tercer método. El Radio-226 tiene un periodo de semidesintegración de 1602 años, así que con él tendremos más exactitud en el cálculo –sólo que es mas difícil de encontrar–. Mismo resultado.

O todos los métodos de datación están equivocados –y dado que se han realizado con éxito miles de experimentos con ellos, y todos ellos son válidos, se ha demostrado, y los errores que se han producido han sido por error de cálculo o deficiencias y negligencias en el protocolo, ésta opción necesitaría una abrumadora cantidad de pruebas– o el señor está mintiendo, equivocandose o inventando.

El que ha dado el testimonio necesitará aportar una carga de prueba equivalente o superior a la carga de pruebas que demuestran la validez y fiabilidad de los métodos radiométricos de datación.

¿Qué es más plausible, que el «testimonio certero» este equivocado o que los cientos de miles de experimentos exitosos estén equivocados?

La ciencia se construye de un modo particular. Si yo publico un descubrimiento siempre voy a tener detrás a un científico que intentará desmantelarme, demostrar que estoy equivocado para llevarse el mérito. Si la datación por radioisótopos fuera errónea ya habría sido desmantelada hace mucho, muchísimo tiempo.

Es decir. El testimonio miente. Y…
los métodos de datación radiactivos no son seguros
… P.L. Nicus también. Amigo, mentir es un pecado. deberías ir a confesión, no vaya a ser. Si tanto predicáis con hacer el bien, ¿por qué mentís?

Quinta parte: la variedad

Pero como ya hemos dicho, el método del 14C no nos sirve para datar ese dinosaurio. ¿Por qué? porque cuando analizamos el dino, nos encontramos que no tiene absolutamente nada de 14C. Esto significa que ha perdido todo el que tenía. Es decir, que han pasado más de 60 000 años –que es el tiempo máximo de resolución del 14C–.
Pero ¡No pasa nada! podemos usar otros radioisótopos de descomposición más lenta.
Usaremos el Calcio-41, que tiene un período de semidesintegración de 103 000 años, y el potasio-40, con 1 280 000 000 años de semidesintegración.

Esa pata de dinosaurio ya no tenía Calcio-41 –es decir, que es más viejo que su tiempo límite, un millón de años–, pero sí tenía Potasio-40: el 96,3% de lo que debería tener. Es decir, que de nuevo haciendo el cálculo adecuado –conocemos el tiempo de semidesintegración– nos encontramos que el ejemplar tiene la friolera de 69 620 000 años. El rango de error es de ente erres y cinco millones de años, pero ¿y qué? sabemos que el bicho vivió entre hace 65 y 75 millones de años. 

Existen muchos radioisótopos que pueden ser usados como método de datación absoluta. Sí, absoluta. No hay calibración en función de una tierra joven o anciana. Simplemente, es un hecho natural que ocurre, y nosotros lo aprovechamos para medir el tiempo que ha transcurrido.

Algunos de los períodos de semidesintegración que conocemos, y que usamos de forma relativamente frecuente son los siguientes. La tabla está sacada de wikipedia, pero hemos comprobado los valores, y son correctos.



Uranio 2357,038 · 108 añosUranio 2384,468 · 109 añosPotasio 401,28 · 109 años
Rubidio 874,88 · 1010 añosCalcio 411,03 · 105 añosCarbono 145760 años
Radio 2261602 añosCesio 13730,07 añosBismuto 20731,55 años
Estroncio 9028,90 añosCobalto 605,271 añosCadmio 109462,6 días
Yodo 1318,02 díasRadón 2223,82 díasOxígeno 15122 segundos
Leer más...